Exercícios de Visão Geral e Código Genético

Voltar para exercícios de Biologia

Quer colocar o estudo em prática? O Stoodi tem exercícios de Visão Geral e Código Genético dos maiores vestibulares do Brasil.

Estude Biologia com esses e mais de 30000 que caíram no ENEM, Fuvest, Unicamp, UFRJ, UNESP e muitos outros vestibulares!

Gerar PDF da Página
  1. 1. UFSM 2010
    Milhares de anos após o último mamute lanoso caminhar sobre a tundra, os cientistas conseguiram sequenciar 50% do genoma desse animal extinto, recuperando boa parte do seu material genético. Sobre o DNA, é possível afirmar I - Na molécula do DNA, são encontradas as quatro bases nitrogenadas: adenina, guanina, citosina e timina. II - A ligação entre as bases complementares da dupla fita do DNA é feita através de pontes de hidrogênio. III - Se, no filamento de DNA. houver a sequência TTTCCATGT, haverá, no seu filamento complementar, a sequência AAAGGUACA. Está(ão) correta(s)
  2. 2. PUC-RS 2005
    A sequência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar
  3. 3. UECE 2015
    Sobre os ácidos nucleicos (DNA e RNA) é correto afirmar que
  4. 4. UFRGS 2013
    Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. (  ) O DNA original atua como molde, e cada novo DNA possui uma fita antiga e outra nova. (  ) Os quatro ribonucleosídeos trifosfatados, dATP, dGTP, dCTP e dUTP, devem estar presentes. (  ) O DNA deve ser desnaturado (desenrolado) para tornar-se acessível ao pareamento das novas bases. (  ) A enzima DNA polimerase adiciona nucleotídeos novos de acordo com o molde de DNA. A sequência correta de preenchimento dos parênteses, de cima para baixo, é
  5. 5. UERN 2012
    Em 1978, o geneticista Walter Gilbert propôs os termos exon para designar as regiões de um gene que codifica uma sequência de aminoácidos, e intron para designar as regiões de um gene não traduzidas, localizadas entre os exons. A Ciência estima que seja de 30 mil o número de genes da espécie humana, no entanto, o número de proteínas diferentes esteja estimado entre 100 mil a 120 mil. Isso ocorre devido ao(à)
  6. 6. UCS 2015
    O invento do microscópio possibilitou o grande avanço da ciência, principalmente a citogenética. Segundo a charge abaixo, pode-se inferir, através de análises citogenéticas, a procedência das células. Assinale a alternativa que está de acordo com a análise feita pelo cientista na charge acima.
  7. 7. UFG 2013
    Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula de ácido fosfórico (P) e uma base nitrogenada (adenina, guanina, timina ou citosina). A ligação entre os nucleotídeos ocorre pela interação entre as bases nitrogenadas específicas, resultando em uma molécula ordenada e bem definida, o DNA. De acordo com essas informações, a estrutura plana que representa um fragmento de DNA e o tipo de ligação química responsável pela interação entre as bases nitrogenadas são, respectivamente,
  8. 8. ULBRA 2012
    Com relação ao DNA e ao RNA, é correto afirmar o seguinte:
  9. 9. UEPB 2012
    O esquema seguinte representa duas cadeias de ácidos nucleicos. Assinale a alternativa correta.
  10. 10. UFSJ 2012
    Em um experimento laboratorial, fez-se a análise da composição de nucleotídeos do ácido nucleico que constitui o material genético de quatro organismos hipotéticos. Os resultados da análise estão descritos na tabela abaixo. Com base nesses resultados, é CORRETO afirmar que
  11. 11. UPE 2013
    Nos ácidos nucleicos, encontram-se bases nitrogenadas formando pares de relativas especificidades. Ao se analisar o DNA de uma determinada bactéria, encontram-se 38% de bases Citosina (C). Que percentuais de bases Adenina (A), Guanina (G) e Timina (T) são esperados, respectivamente?
  12. 12. UPE 2014
    Há 60 anos, Watson e Crick publicaram um artigo sobre a estrutura do ácido desoxirribonucleico (DNA). Leia, a seguir, trechos traduzidos e adaptados da publicação original. (Fonte: Watson, J. D. e Crick, FHC - 1953. Molecular Structure of Nucleia Acid. Nature v. 171, n. 4356, p.737-738). Uma estrutura para o ácido nucleico foi proposta anteriormente por Pauling e Corey (1953), na qual o modelo consiste de três cadeias entrelaçadas com os fosfatos próximos do eixo do filamento e as bases localizadas na parte externa....Fraser também apresenta um modelo de estrutura com três cadeias. Nesse modelo, os fosfatos estão na parte externa, e as bases, na interna, unidas por ligações de hidrogênio (...) Propomos uma estrutura radicalmente diferente para o sal de ácido desoxirribonucleico. Essa estrutura tem duas cadeias helicoidais, cada uma delas enrolada em torno do mesmo eixo (...) Foi observado experimentalmente, por Chargaff e Wyatt (1952), que a razão entre as quantidades de adenina e timina e a razão entre guanina e citosina são sempre muito próximas da unidade para o DNA (...) Os dados de raios-X sobre o DNA, publicados por Atsbury (1974), Wilkins e Randal (1953), são insuficientes, mas compatíveis com os dados experimentais de helicoidização da molécula (...) Não escapou à nossa observação que o emparelhamento específico que postulamos sugere imediatamente um possível mecanismo de cópia para o material genético. (...) Sobre a estrutura do DNA e com base no texto, assinale a alternativa CORRETA.
  13. 13. UECE 2014
    No mecanismo da transcrição, uma das fitas do DNA (a fita molde) é transcrita em RNA mensageiro pela ação de 
  14. 14. CEFET-MG 2014
    Analise o seguinte gráfico. A presença de genomas maiores,mas relativamente com menos genes funcionais, representa uma vantagem adaptativa pelo fato de reduzir a
  15. 15. PUC-SP 1995
    Na aula de Biologia, o professor fez a seguinte afirmação: "A produção de ribossomos depende, indiretamente, da atividade dos cromossomos". Em seguida pediu a seus alunos que analisassem a afirmação e a explicassem. Foram obtidas cinco explicações diferentes, que se encontram a seguir citadas. Assinale a única afirmação correta:
  16. 16. UFSM 2005
    Analise as afirmativas: I. As proteínas e os ácidos nucleicos são formados por aminoácidos. II. DNA e RNA são os ácidos nucleicos encontrados tanto em células eucariontes como procariontes. III. A informação contida no DNA pode ser copiada em uma fita de RNA, através do processo denominado transcrição. IV. A informação presente no RNA pode ser transformada em uma sequência de aminoácidos, através do processo denominado tradução. Está(ão) correta(s)
  17. 17. PUC-RJ 2013
    As tetraciclinas constituem uma classe de antibióticos produzidos por bactérias do gênero Streptomyces. Elas atuam impedindo que o RNA transportador se fixe ao ribossomo nas células bacterianas. Em qual processo biológico este antibiótico atua?
  18. 18. UEPA 2014
    Informações sobre nossos ancestrais podem ser desvendadas pela análise do DNA. Esta ferramenta permite distinguir entre os brasileiros, as contribuições genômicas relativas às três raízes ancestrais: europeia, africana e ameríndia. Adaptado de http://cienciahoje.uol.com.br/colunas/derivagenetica/genealogia-linhagens-ancestrais-e-dna Sobre a molécula orgânica referida no texto, afirma-se que: I. É formada por duas cadeias ou fitas de nucleotídeos, uma em torno da outra, formando uma dupla hélice. II. Ao longo da vida pode ser exposta a diversos fatores externos que podem danificar sua molécula e modificar sua mensagem genética inicial. III. Em interação com o RNA, ribossomos e outros elementos celulares, promove a síntese de proteínas. IV. Nos eucariotos é encontrada no núcleo formando os cromossomos. A alternativa que contém todas as afirmativas corretas é:
  19. 19. PUC-RS 2013
    Se compararmos as sequências de DNA de duas pessoas, veremos que são idênticas  
  20. 20. UERJ 2014
    As características abaixo são referentes aos processos de replicação, transcrição e tradução, que ocorrem em seres vivos. I. A síntese de proteínas tem início antes mesmo do término da transcrição. II. A grande maioria dos genes contém íntrons, retirados antes da tradução. III. A síntese de proteínas sempre ocorre em ribossomos livres no citoplasma. IV. O processo de replicação possui uma única origem. As características I, II, III e IV estão associadas, respectivamente, aos organismos indicados em:
  21. 21. UDESC 2015
    A figura representa, esquematicamente, um nucleotídeo. Esta molécula é de extrema importância para todos os seres vivos em razão dos diferentes papéis que desempenha no interior das células. Um dos papéis está relacionado à sua capacidade de formar diferentes polímeros no interior das células. Analise as proposições em relação ao nucleotídeo. I. Esta estrutura molecular é encontrada nas células de todos os seres vivos. II. Existem cinco tipos de bases nitrogenadas que podem se ligar ao açúcar. III. O açúcar, que se une ao fosfato e à base nitrogenada, tem em sua estrutura 5 carbonos. IV. Os nucleotídeos são as unidades que formam os ácidos nucleicos. V. Nucleotídeos se ligam por meio de suas bases nitrogenadas, e também estabelecem ligações entre o açúcar de um e com o fosfato do outro. Assinale a alternativa correta.
  22. 22. ENEM 2016
    Em 1950, Erwin Chargaff e colaboradores estudavam a composição química do DNA e observaram que a quantidade de adenina (A) é igual à de timina (T), e a quantidade de guanina (G) é igual à de citosina (C) na grande maioria das duplas fitas de DNA. Em outras palavras, esses cientistas descobriram que o total de purinas (A+G) e o total de pirimidinas (C+T) eram iguais.   Um professor trabalhou esses conceitos em sala de aula e apresentou como exemplo uma fita simples de DNA com 20 adeninas, 25 timinas, 30 guaninas e 25 citosinas.   Qual a quantidade de cada um dos nucleotídeos, quando considerada a dupla fita de DNA formada pela fita simples exemplificada pelo professor?
  23. 23. FUVEST 2016
    No esquema abaixo, está representada uma via metabólica; o produto de cada reação química, catalisada por uma enzima específica, é o substrato para a reação seguinte. Num indivíduo que possua alelos mutantes que levem à perda de função do gene
  24. 24. MACKENZIE 2014
    Assinale a alternativa correta a respeito do esquema.
  25. 25. UCS 2012
    O DNA desempenha suas funções por meio do RNA mensageiro (RNAm). A maioria das moléculas de RNA, por sua vez, orienta a produção de proteínas. Considere as seguintes afirmações em relação aos processos de expressão gênica. I. Nos procariotos, a transcrição gênica dá origem a um pré-RNAm, que posteriormente passa pelo processo de splicing para gerar o RNAm. II. Nos eucariotos e procariotos, uma molécula de RNAm passa pela tradução, para dar origem a um peptídeo. III. Nos eucariotos, o ribossomo pode acoplar-se ao retículo endoplasmático, durante o processo de tradução. Das afirmações acima,
  26. 26. UERJ 2012
    Observe a sequência de bases nitrogenadas que compõem a porção inicial de um RNA mensageiro transcrito em uma determinada proteína de uma célula eucariota: AUGGCUAAAUUAGAC.......... Nessa proteína, o aminoácido introduzido pelo códon iniciador foi removido durante o processo de síntese. Admita que uma mutação tenha atingido o códon correspondente ao aminoácido número 3 da estrutura primária desse polipeptídeo, acarretando a troca de uma base A, na célula original, pela base U, na célula mutante. A tabela abaixo permite a identificação dos códons dos aminoácidos encontrados tanto na proteína original como na mutante, codificados pelo trecho inicial desse RNA mensageiro: Aminoácido Códons alanina GCU, GCC, GCA, GCG arginina CGU, CGC, CGA, CGG, AGA, AGG aspártico GAU, GAC fenilalanina UUU, UUC leucina UUA, UUG, CUU, CUC, CUA, CUG lisina AAA, AAG metionina e códon de iniciação AUG serina UCU, UCC, UCA, UCG, AGU, AGC tirosina UAU, UAC triptofano UGG Agora, a estrutura primária da proteína mutante tem como terceiro aminoácido:
  27. 27. PUC-RJ 2014
    Sobre o processo de replicação do DNA, é incorreto afirmar que:
  28. 28. UNIOESTE 2012
    Em uma das fitas de DNA de uma espécie de vírus encontram-se 90 Adeninas e 130 Citosinas. Sabendo-se ainda que nesta fita ocorre um total de 200 bases púricas e 200 bases pirimídicas, assinale a alternativa correta.
  29. 29. UEG 2012
    Em 1962, Watson e Francis Crick receberam o Prêmio Nobel em Fisiologia e em Medicina por terem descoberto o modelo acurado da estrutura do DNA. Acerca da molécula do DNA e suas características, é correto afirmar:
  30. 30. UFG 2013
    Observe a sequência de bases nitrogenadas de um fragmento de DNA apresentado a seguir. TACAAGGTTCTTTGACTATAATTAGCATTC A sequência resultante da transcrição deste fragmento é composta de
Gerar PDF da Página
Conta de email não verificada

Não foi possível realizar o seu cadastro com a sua conta do Facebook pois o seu email não está confirmado no Facebook.

Clique aqui para ver como confirmar sua conta de email no Facebook ou complete seu cadastro por aqui.

Clicando em "Criar perfil", você aceita os termos de uso do Stoodi.
Tem perfil no Stoodi? Fazer Login