Tenha acesso completo ao Stoodi

Plano de estudos, correção de redação, todas as aulas e muito mais!

Exercícios de Biologia

Listagem de exercícios

UFG 2013

Observe a sequência de bases nitrogenadas de um fragmento de DNA apresentado a seguir.

TACAAGGTTCTTTGACTATAATTAGCATTC

A sequência resultante da transcrição deste fragmento é composta de

Conta de email não verificada

Não foi possível realizar o seu cadastro com a sua conta do Facebook pois o seu email não está confirmado no Facebook.

Clique aqui para ver como confirmar sua conta de email no Facebook ou complete seu cadastro por aqui.

Entendi
Clicando em "Criar perfil", você aceita os termos de uso do Stoodi.
Tem perfil no Stoodi? Fazer Login