Tenha acesso completo ao Stoodi

Assine o Stoodi e prepare-se para o ENEM com nossos conteúdos exclusivos!

UFG 2013

Observe a sequência de bases nitrogenadas de um fragmento de DNA apresentado a seguir.

TACAAGGTTCTTTGACTATAATTAGCATTC

A sequência resultante da transcrição deste fragmento é composta de

Escolha uma das alternativas.