Exercícios de Biologia

Listagem de exercícios

UFRGS 2012

O quadro abaixo representa o código genético universal.

A molécula de RNA mensageiro com a sequência CGAAUGACAAAAGGAUAACGU produz o segmento de proteína

Conta de email não verificada

Não foi possível realizar o seu cadastro com a sua conta do Facebook pois o seu email não está confirmado no Facebook.

Clique aqui para ver como confirmar sua conta de email no Facebook ou complete seu cadastro por aqui.

Clicando em "Criar perfil", você aceita os termos de uso do Stoodi.
Tem perfil no Stoodi? Fazer Login