Tenha acesso completo ao Stoodi

Assine o Stoodi e prepare-se para o ENEM com nossos conteúdos exclusivos!

UFRGS 2012

O quadro abaixo representa o código genético universal.

A molécula de RNA mensageiro com a sequência CGAAUGACAAAAGGAUAACGU produz o segmento de proteína

Escolha uma das alternativas.