Tenha acesso completo ao Stoodi

Assine o Stoodi e prepare-se para o ENEM com nossos conteúdos exclusivos!

USF 2018

Nos eucariontes, o RNA transcrito a partir de um gene normalmente é chamado de pré-RNAm, pois ele ainda não está pronto para ser traduzido em proteína. O pré-RNAm seria, assim, uma versão ainda não acabada do RNA mensageiro, que precisa ser primeiramente processado no (I) para, em seguida, migrar ao (II).

Os íntrons são retirados do pré-RNA por meio de enzimas especiais e, em seguida, os éxons são unidos uns aos outros. O RNAm formado apenas por éxons recém-unidos está pronto para sair do núcleo e ser traduzido pelos (III), resultando na formação de uma proteína.

SILVA, Jr, Cesar da & SASSON, Sezar. Biologia: volume 3, 8 ed. São Paulo: Saraiva, 2011, p. 58 e 59.

 

Considere a sequência de códons a seguir e selecione a alternativa que preenche corretamente (I), (II) e (III) e que apresenta o número de aminoácidos incorporados à cadeia polipeptídica.

CCGAUCUACAUGCGGUCUUCAUCAAAUCGGCCGUAGGUAAAUUCCGUA

Escolha uma das alternativas.