Exercícios de Biologia

Listagem de exercícios

USF 2018

Nos eucariontes, o RNA transcrito a partir de um gene normalmente é chamado de pré-RNAm, pois ele ainda não está pronto para ser traduzido em proteína. O pré-RNAm seria, assim, uma versão ainda não acabada do RNA mensageiro, que precisa ser primeiramente processado no (I) para, em seguida, migrar ao (II).

Os íntrons são retirados do pré-RNA por meio de enzimas especiais e, em seguida, os éxons são unidos uns aos outros. O RNAm formado apenas por éxons recém-unidos está pronto para sair do núcleo e ser traduzido pelos (III), resultando na formação de uma proteína.

SILVA, Jr, Cesar da & SASSON, Sezar. Biologia: volume 3, 8 ed. São Paulo: Saraiva, 2011, p. 58 e 59.

 

Considere a sequência de códons a seguir e selecione a alternativa que preenche corretamente (I), (II) e (III) e que apresenta o número de aminoácidos incorporados à cadeia polipeptídica.

CCGAUCUACAUGCGGUCUUCAUCAAAUCGGCCGUAGGUAAAUUCCGUA

Conta de email não verificada

Não foi possível realizar o seu cadastro com a sua conta do Facebook pois o seu email não está confirmado no Facebook.

Clique aqui para ver como confirmar sua conta de email no Facebook ou complete seu cadastro por aqui.

Entendi
Clicando em "Criar perfil", você aceita os termos de uso do Stoodi.
Tem perfil no Stoodi? Fazer Login